ID: 1049223221_1049223233

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1049223221 1049223233
Species Human (GRCh38) Human (GRCh38)
Location 8:141437154-141437176 8:141437188-141437210
Sequence CCTGGCCCTGCCCGCCGTGGGGA CGGCCTGGCCCTGCCCGCCGTGG
Strand - +
Off-target summary No data {0: 6, 1: 2, 2: 8, 3: 66, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!