ID: 1049223273_1049223278

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1049223273 1049223278
Species Human (GRCh38) Human (GRCh38)
Location 8:141437279-141437301 8:141437300-141437322
Sequence CCGTGGGGAGCTGTGGGTCCTGG GGCCTGGCCCTGCCCGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 4, 3: 60, 4: 540} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!