ID: 1049229946_1049229955

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1049229946 1049229955
Species Human (GRCh38) Human (GRCh38)
Location 8:141476794-141476816 8:141476826-141476848
Sequence CCGTGGCTCCCGGGGCCCTCAGG CCTGCCACCCTGGCCCTCTGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!