ID: 1049399275_1049399285

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1049399275 1049399285
Species Human (GRCh38) Human (GRCh38)
Location 8:142417649-142417671 8:142417687-142417709
Sequence CCCATGGGGACCCCAGTCTGTTT TTCCTGATGCTCCCGAGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!