ID: 1049673282_1049673299

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1049673282 1049673299
Species Human (GRCh38) Human (GRCh38)
Location 8:143878982-143879004 8:143879033-143879055
Sequence CCAGGCCTCACCCCCCGGTCTGG CCTGTCACCCTGGGAGTACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 14, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!