ID: 1049766221_1049766231

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1049766221 1049766231
Species Human (GRCh38) Human (GRCh38)
Location 8:144356477-144356499 8:144356513-144356535
Sequence CCACCCCTCGTCCCGGAGGCTTG GGTTCAACAGCCGCAGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 96} {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!