ID: 1049766228_1049766234

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1049766228 1049766234
Species Human (GRCh38) Human (GRCh38)
Location 8:144356489-144356511 8:144356516-144356538
Sequence CCGGAGGCTTGGGCAGCCACATC TCAACAGCCGCAGCACCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 265} {0: 1, 1: 0, 2: 3, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!