ID: 1049832843_1049832848

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049832843 1049832848
Species Human (GRCh38) Human (GRCh38)
Location 8:144713303-144713325 8:144713318-144713340
Sequence CCCGCCCGGCGTTGCCTCAGCAC CTCAGCACATCCCTGACCGTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 5, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!