ID: 1049832844_1049832849

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1049832844 1049832849
Species Human (GRCh38) Human (GRCh38)
Location 8:144713304-144713326 8:144713321-144713343
Sequence CCGCCCGGCGTTGCCTCAGCACA AGCACATCCCTGACCGTCGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!