ID: 1050690391_1050690396

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1050690391 1050690396
Species Human (GRCh38) Human (GRCh38)
Location 9:8221147-8221169 9:8221166-8221188
Sequence CCTACCTAACGAGGTCAGGAAGA AAGACTAAGGAGAAGCAGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!