ID: 1051029466_1051029480

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1051029466 1051029480
Species Human (GRCh38) Human (GRCh38)
Location 9:12657659-12657681 9:12657698-12657720
Sequence CCCCAGAACTTCCTTCCAACCCC TCCATGAAGGGAAACTGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 360} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!