ID: 1051272086_1051272097

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1051272086 1051272097
Species Human (GRCh38) Human (GRCh38)
Location 9:15365514-15365536 9:15365547-15365569
Sequence CCCACCGGACCCAGAAGCCCAGC TCAGACACCAGCACTTTGGGAGG
Strand - +
Off-target summary {0: 11, 1: 234, 2: 389, 3: 1303, 4: 1033} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!