ID: 1051822275_1051822282

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1051822275 1051822282
Species Human (GRCh38) Human (GRCh38)
Location 9:21181738-21181760 9:21181755-21181777
Sequence CCCACCCGTCACATCACCAGGCA CAGGCAGGGAACCCCTGTCTTGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 26, 3: 68, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!