ID: 1051822989_1051822995

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1051822989 1051822995
Species Human (GRCh38) Human (GRCh38)
Location 9:21190870-21190892 9:21190906-21190928
Sequence CCTGCCCTAAGCAAGACTCCAGG GATGAAATCCAGTGTGGAGCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 19, 4: 226} {0: 3, 1: 0, 2: 5, 3: 10, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!