ID: 1052227587_1052227590 |
View in Genome Browser |
Spacer: 11 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1052227587 | 1052227590 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 9:26108350-26108372 | 9:26108384-26108406 |
| Sequence | CCATCTTCTGCAAATAACTACTC | GACAGCTCTTGGCCTGTTACTGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||