|
Left Crispr |
Right Crispr |
| Crispr ID |
1052227825 |
1052227829 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
9:26110172-26110194
|
9:26110200-26110222
|
| Sequence |
CCGTTAGGGCATCTCTTAGTATT |
GCCCTGTGATTACGGTCAATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 96, 1: 173, 2: 206, 3: 192, 4: 222} |
{0: 2, 1: 214, 2: 236, 3: 146, 4: 101} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|