ID: 1052390497_1052390500

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1052390497 1052390500
Species Human (GRCh38) Human (GRCh38)
Location 9:27873363-27873385 9:27873396-27873418
Sequence CCGGCATCTAATTTTCTACCTTC CAGGAATCTGCTGTTATCTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!