ID: 1052901789_1052901793

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1052901789 1052901793
Species Human (GRCh38) Human (GRCh38)
Location 9:33799742-33799764 9:33799773-33799795
Sequence CCTAGTTCCATCTCTGTGAGCAG GATGTTCCACCTACCATAGCGGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 28, 4: 207} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!