ID: 1053052868_1053052873

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1053052868 1053052873
Species Human (GRCh38) Human (GRCh38)
Location 9:34976405-34976427 9:34976427-34976449
Sequence CCCTGGCCATGGGAGGCAGAGAC CTTAGCAAGAGCTGTGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 85, 4: 568} {0: 1, 1: 0, 2: 2, 3: 12, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!