ID: 1053052870_1053052873

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1053052870 1053052873
Species Human (GRCh38) Human (GRCh38)
Location 9:34976411-34976433 9:34976427-34976449
Sequence CCATGGGAGGCAGAGACTTAGCA CTTAGCAAGAGCTGTGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 283} {0: 1, 1: 0, 2: 2, 3: 12, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!