ID: 1053052870_1053052877

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1053052870 1053052877
Species Human (GRCh38) Human (GRCh38)
Location 9:34976411-34976433 9:34976438-34976460
Sequence CCATGGGAGGCAGAGACTTAGCA CTGTGGGTTTGGGGGCCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 283} {0: 1, 1: 0, 2: 1, 3: 27, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!