ID: 1053168943_1053168951

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1053168943 1053168951
Species Human (GRCh38) Human (GRCh38)
Location 9:35864775-35864797 9:35864802-35864824
Sequence CCTACTGGCCATGGCCTAAATGT AGGGAGCTGGAGCCAGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121} {0: 1, 1: 0, 2: 5, 3: 72, 4: 621}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!