ID: 1053296904_1053296907

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1053296904 1053296907
Species Human (GRCh38) Human (GRCh38)
Location 9:36921927-36921949 9:36921946-36921968
Sequence CCTCGGACACCTGTGGGGTCAGC CAGCAAAGGCTTACTCCAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!