ID: 1053496896_1053496904

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1053496896 1053496904
Species Human (GRCh38) Human (GRCh38)
Location 9:38554711-38554733 9:38554763-38554785
Sequence CCAAGCTGTACCTGTGCATCTTT ATGTAGGCAGCATTGTCCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 83, 3: 154, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!