ID: 1053497506_1053497514

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1053497506 1053497514
Species Human (GRCh38) Human (GRCh38)
Location 9:38559173-38559195 9:38559213-38559235
Sequence CCCTCAGTATGGAAAAGCTACAG AGTCCATGAGAGCAGCCATGGGG
Strand - +
Off-target summary No data {0: 4, 1: 60, 2: 113, 3: 550, 4: 1044}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!