ID: 1053752826_1053752841

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1053752826 1053752841
Species Human (GRCh38) Human (GRCh38)
Location 9:41273671-41273693 9:41273716-41273738
Sequence CCGCCCAGTCCTCCACCTGAGGG CCCTCAGCAGTCACCCCGTGTGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 5, 3: 25, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!