ID: 1053840662_1053840670

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1053840662 1053840670
Species Human (GRCh38) Human (GRCh38)
Location 9:42186339-42186361 9:42186371-42186393
Sequence CCTCTGGCCTGCTCTCCGCCTCC CTTCACTGCTCCTCCCCTGCGGG
Strand - +
Off-target summary {0: 4, 1: 5, 2: 13, 3: 76, 4: 636} {0: 5, 1: 4, 2: 3, 3: 33, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!