ID: 1053841011_1053841023

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1053841011 1053841023
Species Human (GRCh38) Human (GRCh38)
Location 9:42188396-42188418 9:42188434-42188456
Sequence CCCATCTTGGAATGATCATGGGC CAGCTGGACAGGAGGGCAGGTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 5, 3: 9, 4: 70} {0: 9, 1: 0, 2: 12, 3: 110, 4: 776}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!