ID: 1053913412_1053913418

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1053913412 1053913418
Species Human (GRCh38) Human (GRCh38)
Location 9:42927576-42927598 9:42927604-42927626
Sequence CCTGCGGTTCCAGCTCCAGCCAT AAAGATGCACAGGTACAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 97, 3: 303, 4: 626} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!