ID: 1053915320_1053915327

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1053915320 1053915327
Species Human (GRCh38) Human (GRCh38)
Location 9:42941414-42941436 9:42941466-42941488
Sequence CCTCAGAACACTGCTGCCTGCAT AAAGATGCACAGGTACAGCTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!