ID: 1054272650_1054272658

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1054272650 1054272658
Species Human (GRCh38) Human (GRCh38)
Location 9:63045435-63045457 9:63045482-63045504
Sequence CCAACGTTGGGGCAGGGCAAATC CTCTGGCCCTGCCTTGGCCCTGG
Strand - +
Off-target summary No data {0: 32, 1: 6, 2: 64, 3: 186, 4: 1091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!