ID: 1054392291_1054392295

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1054392291 1054392295
Species Human (GRCh38) Human (GRCh38)
Location 9:64626521-64626543 9:64626535-64626557
Sequence CCAAGGGGTGATATGTGGATACA GTGGATACACGGGTGGTTAATGG
Strand - +
Off-target summary {0: 7, 1: 2, 2: 0, 3: 3, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!