ID: 1054426928_1054426943

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1054426928 1054426943
Species Human (GRCh38) Human (GRCh38)
Location 9:65131706-65131728 9:65131746-65131768
Sequence CCAGGAAGGAGAGGACCCCACCC GTGGATACACGGGTGGTTAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!