ID: 1054445947_1054445952

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1054445947 1054445952
Species Human (GRCh38) Human (GRCh38)
Location 9:65315902-65315924 9:65315943-65315965
Sequence CCCTACTCCATCTGTAAAAACCT CAGGTCAATGACTGCCTTCTCGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 3, 3: 12, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!