ID: 1055093365_1055093369

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1055093365 1055093369
Species Human (GRCh38) Human (GRCh38)
Location 9:72385474-72385496 9:72385488-72385510
Sequence CCCTCAACATACTAAGTGCTAAG AGTGCTAAGTACCATCGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!