ID: 1056078155_1056078169

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1056078155 1056078169
Species Human (GRCh38) Human (GRCh38)
Location 9:83062580-83062602 9:83062624-83062646
Sequence CCCCGCCTCAGACACGGCGGGCG CCCGGCGCCGCCCCCCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61} {0: 1, 1: 0, 2: 7, 3: 59, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!