ID: 1056078155_1056078171

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1056078155 1056078171
Species Human (GRCh38) Human (GRCh38)
Location 9:83062580-83062602 9:83062625-83062647
Sequence CCCCGCCTCAGACACGGCGGGCG CCGGCGCCGCCCCCCGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61} {0: 1, 1: 0, 2: 0, 3: 41, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!