ID: 1056323907_1056323910

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1056323907 1056323910
Species Human (GRCh38) Human (GRCh38)
Location 9:85460979-85461001 9:85460993-85461015
Sequence CCGTGTCCCATCTGTGTGGGACC TGTGGGACCCCACTGAAAATCGG
Strand - +
Off-target summary No data {0: 173, 1: 150, 2: 196, 3: 148, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!