ID: 1056353869_1056353876

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1056353869 1056353876
Species Human (GRCh38) Human (GRCh38)
Location 9:85778303-85778325 9:85778348-85778370
Sequence CCAAAGCCCAGTAACAGGCCAAG AGTTATCTGCAGAAGATGGCGGG
Strand - +
Off-target summary {0: 169, 1: 171, 2: 103, 3: 76, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!