ID: 1056514822_1056514833

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1056514822 1056514833
Species Human (GRCh38) Human (GRCh38)
Location 9:87340280-87340302 9:87340323-87340345
Sequence CCTTGCCTTGCTGTTCCCATCAC AGGAAAAAAGCAAGTGGGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 391} {0: 1, 1: 0, 2: 0, 3: 36, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!