ID: 1056586782_1056586792

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1056586782 1056586792
Species Human (GRCh38) Human (GRCh38)
Location 9:87932425-87932447 9:87932467-87932489
Sequence CCACTGACCAGGTCCCCACTGAC TCACCAGGTCCCCATTGGTGAGG
Strand - +
Off-target summary {0: 6, 1: 25, 2: 77, 3: 157, 4: 459} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!