ID: 1056610086_1056610092

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1056610086 1056610092
Species Human (GRCh38) Human (GRCh38)
Location 9:88120474-88120496 9:88120503-88120525
Sequence CCTCACCAGTAGGGATCTGGTGA CATTGGAAGCCTAGTCAGTGGGG
Strand - +
Off-target summary No data {0: 5, 1: 13, 2: 3, 3: 8, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!