ID: 1056747734_1056747747

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1056747734 1056747747
Species Human (GRCh38) Human (GRCh38)
Location 9:89318742-89318764 9:89318775-89318797
Sequence CCTACCGGGTGGCCGCGATCTTC TCGGGTCCGCCTTGGGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24} {0: 1, 1: 0, 2: 1, 3: 8, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!