ID: 1056871719_1056871727

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1056871719 1056871727
Species Human (GRCh38) Human (GRCh38)
Location 9:90288024-90288046 9:90288063-90288085
Sequence CCATCAGAGCCTGCCCCAGCCAC TCTACTGGAACTCTTTCCCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!