ID: 1057242653_1057242657

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1057242653 1057242657
Species Human (GRCh38) Human (GRCh38)
Location 9:93425533-93425555 9:93425571-93425593
Sequence CCTCATGCCAGCACCATATTGTT TTGTAATAAGCTTCAAAATCGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 20, 3: 153, 4: 843}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!