ID: 1057397413_1057397426

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1057397413 1057397426
Species Human (GRCh38) Human (GRCh38)
Location 9:94692425-94692447 9:94692474-94692496
Sequence CCACTCCCCAGGGCATAGGGCGG TTCTGAGGGCAAAGGGAGTTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 50, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!