ID: 1057872897_1057872907

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1057872897 1057872907
Species Human (GRCh38) Human (GRCh38)
Location 9:98731620-98731642 9:98731662-98731684
Sequence CCTGGGAGGTCCCTATGCTGATG TGGGCAGGGCCCCAAGTTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 201} {0: 1, 1: 0, 2: 3, 3: 28, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!