ID: 1058109569_1058109576

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1058109569 1058109576
Species Human (GRCh38) Human (GRCh38)
Location 9:101017683-101017705 9:101017709-101017731
Sequence CCTGGTGAGAATTTTCTTGTTGG CTCACATGGTGAAGGCAGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!