ID: 1058544165_1058544170

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1058544165 1058544170
Species Human (GRCh38) Human (GRCh38)
Location 9:106042742-106042764 9:106042783-106042805
Sequence CCAGTAATAGGCCAAGAGCTGTC TATATCTGCAGAAGATGGCAGGG
Strand - +
Off-target summary {0: 17, 1: 183, 2: 194, 3: 123, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!