ID: 1058544910_1058544916

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1058544910 1058544916
Species Human (GRCh38) Human (GRCh38)
Location 9:106050931-106050953 9:106050970-106050992
Sequence CCTGGGATTGCTCCTACATAAAC TTTGTCTTCGGGTCTGCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 10, 3: 70, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!